px459 sgrna2 vectors Search Results


93
Addgene inc px459 sgrna2 vectors
Px459 Sgrna2 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/px459-TDP+43+sgRNA2+(Plasmid+%23133763)/pmc08998713-182-27-14
Average 93 stars, based on 1 article reviews
px459 sgrna2 vectors - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

91
Addgene inc sgrna 2
Sgrna 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/PAX6+sgRNA2+(Plasmid+%2368465)/pmc09274754__thnov12p4866s1-27-4-22
Average 91 stars, based on 1 article reviews
sgrna 2 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
Addgene inc sgrna2
sgRNA targets the pre-miR-130b coding sequence in goat, and gene-editing analysis of single-cell clone. ( A ) Pre-miR-130b genomic sequence and its corresponding sgRNAs selection. sgRNA1 and <t>sgRNA2</t> are displayed as horizontal arrowheads (black), and PAM sequences are underlined and in red. miR-130b-5p and miR-130b-3p genomic sequences are shown in green and blue, respectively. ( B ) Cleavage efficiency of the PCR product spanning pre-miR-130b sequence was detected via T7EN1 assay and the intensity of bands was calculated by ImageJ. ( C ) DNA sequencing confirmed the indels sequence in miR-130b alleles in the single clone. Wild type (WT) and nucleotide deletion (-) are displayed on the right and deleted nucleotides are indicated with a red dotted line.
Sgrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/USP19+sgRNA2+(Plasmid+%2378586)/pmc08998713-182-5-14
Average 93 stars, based on 1 article reviews
sgrna2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc px459 sgrna1
sgRNA targets the pre-miR-130b coding sequence in goat, and gene-editing analysis of single-cell clone. ( A ) Pre-miR-130b genomic sequence and its corresponding sgRNAs selection. sgRNA1 and <t>sgRNA2</t> are displayed as horizontal arrowheads (black), and PAM sequences are underlined and in red. miR-130b-5p and miR-130b-3p genomic sequences are shown in green and blue, respectively. ( B ) Cleavage efficiency of the PCR product spanning pre-miR-130b sequence was detected via T7EN1 assay and the intensity of bands was calculated by ImageJ. ( C ) DNA sequencing confirmed the indels sequence in miR-130b alleles in the single clone. Wild type (WT) and nucleotide deletion (-) are displayed on the right and deleted nucleotides are indicated with a red dotted line.
Px459 Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/px459-TDP-43+sgRNA1+(Plasmid+%23133762)/pmc08998713-182-25-14
Average 93 stars, based on 1 article reviews
px459 sgrna1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Addgene inc px459 vector
Sequences and positions of the primers and sgRNAs utilized in this study.
Px459 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/pcDNA3%2E1(%2B)+Laccase2+MCS+Exon+Vector+(Plasmid+%2369893)/pmc09029512-133-10-12
Average 96 stars, based on 1 article reviews
px459 vector - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Addgene inc pspcas9 bb 2a puro plasmid
Sequences and positions of the primers and sgRNAs utilized in this study.
Pspcas9 Bb 2a Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc08998713-182-10-14
Average 96 stars, based on 1 article reviews
pspcas9 bb 2a puro plasmid - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Addgene inc cas9 expression vector pspcas9 bb 2a puro
Sequences and positions of the primers and sgRNAs utilized in this study.
Cas9 Expression Vector Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/pSpCas9(BB)-2A-Puro+(PX459)+(Plasmid+%2348139)/pm34282029-354-1-6
Average 96 stars, based on 1 article reviews
cas9 expression vector pspcas9 bb 2a puro - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Addgene inc sgrna 1
Sequences and positions of the primers and sgRNAs utilized in this study.
Sgrna 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/pLH-sgRNA1+(Plasmid+%2375388)/pmc09274754__thnov12p4866s1-27-1-22
Average 93 stars, based on 1 article reviews
sgrna 1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Addgene inc spcas9
Sequences and positions of the primers and sgRNAs utilized in this study.
Spcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/SP-Cas9+(Plasmid+%2362731)/pm32373541-100-12-22
Average 96 stars, based on 1 article reviews
spcas9 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Addgene inc c terminal flag tag
Sequences and positions of the primers and sgRNAs utilized in this study.
C Terminal Flag Tag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/C+terminal+Flag+Mios+pRK5+(Plasmid+%2346326)/bio_rxiv__2024__09__28__615627-122-12-70
Average 93 stars, based on 1 article reviews
c terminal flag tag - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc sirt6 sgrna1 cctgaagtcggggatgccag
(A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant <t>Sirt6</t> and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.
Sirt6 Sgrna1 Cctgaagtcggggatgccag, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/px459+sgrna2+vectors/SIRT6+Flag+(Plasmid+%2313817)/bio_rxiv__2024__09__28__615627-122-45-70
Average 93 stars, based on 1 article reviews
sirt6 sgrna1 cctgaagtcggggatgccag - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


sgRNA targets the pre-miR-130b coding sequence in goat, and gene-editing analysis of single-cell clone. ( A ) Pre-miR-130b genomic sequence and its corresponding sgRNAs selection. sgRNA1 and sgRNA2 are displayed as horizontal arrowheads (black), and PAM sequences are underlined and in red. miR-130b-5p and miR-130b-3p genomic sequences are shown in green and blue, respectively. ( B ) Cleavage efficiency of the PCR product spanning pre-miR-130b sequence was detected via T7EN1 assay and the intensity of bands was calculated by ImageJ. ( C ) DNA sequencing confirmed the indels sequence in miR-130b alleles in the single clone. Wild type (WT) and nucleotide deletion (-) are displayed on the right and deleted nucleotides are indicated with a red dotted line.

Journal: International Journal of Molecular Sciences

Article Title: CRISPR/Cas9-Mediated Knockout of miR-130b Affects Mono- and Polyunsaturated Fatty Acid Content via PPARG-PGC1α Axis in Goat Mammary Epithelial Cells

doi: 10.3390/ijms23073640

Figure Lengend Snippet: sgRNA targets the pre-miR-130b coding sequence in goat, and gene-editing analysis of single-cell clone. ( A ) Pre-miR-130b genomic sequence and its corresponding sgRNAs selection. sgRNA1 and sgRNA2 are displayed as horizontal arrowheads (black), and PAM sequences are underlined and in red. miR-130b-5p and miR-130b-3p genomic sequences are shown in green and blue, respectively. ( B ) Cleavage efficiency of the PCR product spanning pre-miR-130b sequence was detected via T7EN1 assay and the intensity of bands was calculated by ImageJ. ( C ) DNA sequencing confirmed the indels sequence in miR-130b alleles in the single clone. Wild type (WT) and nucleotide deletion (-) are displayed on the right and deleted nucleotides are indicated with a red dotted line.

Article Snippet: Then, the double-strand sgRNA1 and sgRNA2 were inserted into the pSpCas9 (BB)-2A-Puro plasmid (62988, Addgene, Cambridge, UK) at the Bbs I site, to construct the PX459-sgRNA1 and PX459-sgRNA2 vectors, respectively.

Techniques: Sequencing, Selection, Genomic Sequencing, DNA Sequencing

Sequences and positions of the primers and sgRNAs utilized in this study.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: Sequences and positions of the primers and sgRNAs utilized in this study.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques:

sgRNA of gE inhibits BoHV-1 replication and screening of BoHV-1 gE/EGFP + . ( A ) sgRNA inhibits the formation of BoHV-1 plaques. A total of 2 μg of px459-gE-sgRNA1, 2, 3, 4, and px459 were co-transfected into VERO E6 cells. After 12 h, the cells were infected with BoHV-1 (MOI = 1). The virus was collected at 72 hpi and a plaque assay was performed. ( B ) The virus titer of BoHV-1 when it was proceeded with sgRNA of gE on MDBK cells. ( C ) The fluorescent cells indicated that BoHV-1 gE/EGFP + was produced. ( Ca ) bright field; ( Cb ) F0 of rescued recombinant virus. ( D ) The fluorescent spot when cloning and purifying the EGFP-positive viruses. ( E ) PCR identification of BoHV-1 gE/EGFP + . The viral genome was extracted from the supernatant after the purification of sixth-generation clones. PCR amplification was performed using BoHV-gE-F/R primers. The negative control was double distilled water. Lane 1: DNA marker 2000, lane 2: BoHV-1gE/EGFP + , lane 3: wtBoHV-1, lane 4: negative control. The data are shown as mean ± SD; * p < 0.05.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: sgRNA of gE inhibits BoHV-1 replication and screening of BoHV-1 gE/EGFP + . ( A ) sgRNA inhibits the formation of BoHV-1 plaques. A total of 2 μg of px459-gE-sgRNA1, 2, 3, 4, and px459 were co-transfected into VERO E6 cells. After 12 h, the cells were infected with BoHV-1 (MOI = 1). The virus was collected at 72 hpi and a plaque assay was performed. ( B ) The virus titer of BoHV-1 when it was proceeded with sgRNA of gE on MDBK cells. ( C ) The fluorescent cells indicated that BoHV-1 gE/EGFP + was produced. ( Ca ) bright field; ( Cb ) F0 of rescued recombinant virus. ( D ) The fluorescent spot when cloning and purifying the EGFP-positive viruses. ( E ) PCR identification of BoHV-1 gE/EGFP + . The viral genome was extracted from the supernatant after the purification of sixth-generation clones. PCR amplification was performed using BoHV-gE-F/R primers. The negative control was double distilled water. Lane 1: DNA marker 2000, lane 2: BoHV-1gE/EGFP + , lane 3: wtBoHV-1, lane 4: negative control. The data are shown as mean ± SD; * p < 0.05.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques: Transfection, Infection, Virus, Plaque Assay, Produced, Recombinant, Cloning, Purification, Clone Assay, Amplification, Negative Control, Marker

sgRNA of EGFP inhibited the formation of BoHV-1 gE/EGFP + plaques and the targeted deletion of EGFP. ( A ) The plaques with different sgRNAs of EGFP. Two micrograms of px459-gE-sgRNA1, 2, 3, or px459 were transfected into VERO E6 cells. After 12 h, the cells were infected with BoHV-1 gE/EGFP + (MOI = 1) and the virus was fixed and stained for plaque testing at 72 hpi. ( B ) The virus titer with sgRNA of EGFP editing on MDBK cells. ( C ) The cytopathic effect and no fluorescence of BoHV-1 gE/EGFP − ( Ca ) bright field; ( Cb ) fluorescence field. The red arrow indicates first-generation BoHV-1 gE/EGFP − recombinant viruses. ( D ) PCR identification of BoHV-1 gE/EGFP − . The purified viral genome was extracted and PCR amplification was performed using BHV-gE-F/R primers. The negative control was double distilled water. Lane 1: DNA marker 2000, lane 2: wtBoHV-1, lane 3: BoHV-1gE/EGFP + , lane 4: BoHV-1gE/EGFP − , lane 5: negative control. The data are shown as mean ± SD; * p < 0.05.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: sgRNA of EGFP inhibited the formation of BoHV-1 gE/EGFP + plaques and the targeted deletion of EGFP. ( A ) The plaques with different sgRNAs of EGFP. Two micrograms of px459-gE-sgRNA1, 2, 3, or px459 were transfected into VERO E6 cells. After 12 h, the cells were infected with BoHV-1 gE/EGFP + (MOI = 1) and the virus was fixed and stained for plaque testing at 72 hpi. ( B ) The virus titer with sgRNA of EGFP editing on MDBK cells. ( C ) The cytopathic effect and no fluorescence of BoHV-1 gE/EGFP − ( Ca ) bright field; ( Cb ) fluorescence field. The red arrow indicates first-generation BoHV-1 gE/EGFP − recombinant viruses. ( D ) PCR identification of BoHV-1 gE/EGFP − . The purified viral genome was extracted and PCR amplification was performed using BHV-gE-F/R primers. The negative control was double distilled water. Lane 1: DNA marker 2000, lane 2: wtBoHV-1, lane 3: BoHV-1gE/EGFP + , lane 4: BoHV-1gE/EGFP − , lane 5: negative control. The data are shown as mean ± SD; * p < 0.05.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques: Transfection, Infection, Virus, Staining, Fluorescence, Recombinant, Purification, Amplification, Negative Control, Marker

Editing CRISPR/Cas9 induces high-efficiency mutations in the BoHV-1 genome. ( A ) Summary of representative mutations of BoHV-1 induced with px459-EGFP-sgRNA1 and px459-EGFP-sgRNA2 appearing outside the EGFP sequence. ( B ) Summary of representative mutations of BoHV-1 induced with px459-EGFP-sgRNA1 and px459-EGFP-sgRNA2 appearing inside the EGFP sequence.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: Editing CRISPR/Cas9 induces high-efficiency mutations in the BoHV-1 genome. ( A ) Summary of representative mutations of BoHV-1 induced with px459-EGFP-sgRNA1 and px459-EGFP-sgRNA2 appearing outside the EGFP sequence. ( B ) Summary of representative mutations of BoHV-1 induced with px459-EGFP-sgRNA1 and px459-EGFP-sgRNA2 appearing inside the EGFP sequence.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques: CRISPR, Sequencing

The gene editing in BoHV-1 gE/EGFP + using  px459-gE-sgRNA1/px459-gE-sgRNA2/px459.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: The gene editing in BoHV-1 gE/EGFP + using px459-gE-sgRNA1/px459-gE-sgRNA2/px459.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques:

The gene editing in BoHV-1 gE/EGFP − using  px459-EGFP-sgRNA1/px459-EGFP-sgRNA2/px459.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: The gene editing in BoHV-1 gE/EGFP − using px459-EGFP-sgRNA1/px459-EGFP-sgRNA2/px459.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques:

Summary of the phenomena that occur in BoHV-1 gE /US9/EGFP − using  px459-EGFP-sgRNA1/px459-EGFP-sgRNA2/px459.

Journal: Veterinary Sciences

Article Title: Concurrent Gene Insertion, Deletion, and Inversion during the Construction of a Novel Attenuated BoHV-1 Using CRISPR/Cas9 Genome Editing

doi: 10.3390/vetsci9040166

Figure Lengend Snippet: Summary of the phenomena that occur in BoHV-1 gE /US9/EGFP − using px459-EGFP-sgRNA1/px459-EGFP-sgRNA2/px459.

Article Snippet: The sgRNAs were denatured, annealed, extended, and cloned into the px459 vector (Addgene) to obtain px459-gE-sgRNA1, px459-gE-sgRNA2, px459-gE-sgRNA3, and px459-gE-sgRNA4.

Techniques:

(A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant Sirt6 and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot of histone Kla levels on nucleosomes isolated from HEK-293T cells that were incubated with recombinant Sirt6 and/or NAD + . (B) Quantitation of the blot from panel A. Densitometry data were corrected based on the total protein stain then normalized to the untreated control condition. Groups were compared using a one-way ANOVA followed by Tukey’s post hoc test. n=3, error plotted as S.D. p (-/-v. +/+) = 0.006. (C) Western blot analysis of time courses of enzymatic deacylation reactions using 25 nM substrate nucleosome, 100 nM Sirt6, and 1 mM NAD + . (D) Quantitation of western blot data for the H3K9Ac substrate in panel C. V I was calculated for each substrate concentration by fitting the first three data points from this curve using standard linear regression. (E) As in panel D, but for the H3K9La substrate. (F) V I values plotted as a function of substrate concentration for each PTM substrate. For panels D, E, and F, n=3, error plotted as S.D.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Isolation, Incubation, Recombinant, Quantitation Assay, Staining, Control, Concentration Assay

(A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and Sirt7 knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and Sirt7 knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Knock-Out, Titration, Staining, Control

(A) Western blot using a pan-lactyllysine antibody (PTM BIO) to analyze Kla levels on acid-extracted histones from wild type and Sirt6 knockout U2OS cells in the presence of a titration of rotenone, a mitochondrial Complex I inhibitor. Total protein was measured using a fluorescent total protein stain (LI-COR). (B) Antibody signal was corrected based on the loading control signal, then normalized as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test, p=0.0005 (C) As in panel A but using the pan-acetyllysine antibody to measure levels of histone Kac. (D) Quantitation of data from panel C. Data were processed as in panel B. n=3, error plotted as S.D.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot using a pan-lactyllysine antibody (PTM BIO) to analyze Kla levels on acid-extracted histones from wild type and Sirt6 knockout U2OS cells in the presence of a titration of rotenone, a mitochondrial Complex I inhibitor. Total protein was measured using a fluorescent total protein stain (LI-COR). (B) Antibody signal was corrected based on the loading control signal, then normalized as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test, p=0.0005 (C) As in panel A but using the pan-acetyllysine antibody to measure levels of histone Kac. (D) Quantitation of data from panel C. Data were processed as in panel B. n=3, error plotted as S.D.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Knock-Out, Titration, Staining, Control, Quantitation Assay

(A) Levels of various histone acyl PTMs on acid-extracted histones from wild type or Sirt6 knockout U2OS cells were measured using site-specific antibodies (CST and PTM BIO). Total protein in each sample was measured using a fluorescent total protein stain (LI-COR). (B) Quantitation of data from panel A. Data were corrected based on the Revert 700 total protein stain, then normalized to the - Lactate control condition. Statistical analysis was performed using Student’s t-test and corrected for multiple hypothesis testing using the Holm-Šídák correction. n=3, error plotted as S.D. H3K9La p=0.013, H3K18La p=0.019.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Levels of various histone acyl PTMs on acid-extracted histones from wild type or Sirt6 knockout U2OS cells were measured using site-specific antibodies (CST and PTM BIO). Total protein in each sample was measured using a fluorescent total protein stain (LI-COR). (B) Quantitation of data from panel A. Data were corrected based on the Revert 700 total protein stain, then normalized to the - Lactate control condition. Statistical analysis was performed using Student’s t-test and corrected for multiple hypothesis testing using the Holm-Šídák correction. n=3, error plotted as S.D. H3K9La p=0.013, H3K18La p=0.019.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Knock-Out, Staining, Quantitation Assay, Control

(A) Western blot measuring histone Kla on acid-extracted histones in WT and Sirt6-KO U2OS cell lines not treated with supplemental L-lactate with and without overexpression of human Sir6 under the control of a CMV promoter. WT histone H3 (CST) is used as a loading control. (B) Western blot measuring Sirt6 in the soluble protein fraction from cell lines from (a). β-Actin is used as a loading control. (C) Kla signal from (a) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. (D) as in (a) but measuring histone Kac. (E) as in (c), but for Kac data from (d) (F) As in (a), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to histone extraction. (G) As in (b), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to cell lysis. (H) Kla signal from (f) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. (I) Inverse correlation of data from (f) and (g). Sirt6 signal was normalized by dividing by the β-actin loading control. Kla signal was normalized as in (h). The data were analyzed using a standard linear regression, R 2 = 0.84.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot measuring histone Kla on acid-extracted histones in WT and Sirt6-KO U2OS cell lines not treated with supplemental L-lactate with and without overexpression of human Sir6 under the control of a CMV promoter. WT histone H3 (CST) is used as a loading control. (B) Western blot measuring Sirt6 in the soluble protein fraction from cell lines from (a). β-Actin is used as a loading control. (C) Kla signal from (a) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. (D) as in (a) but measuring histone Kac. (E) as in (c), but for Kac data from (d) (F) As in (a), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to histone extraction. (G) As in (b), but the cells were treated with 25 mM sodium L-lactate for 24 hours prior to cell lysis. (H) Kla signal from (f) was quantified, normalized to the loading control, and represented as a fold change from the average of the WT condition. (I) Inverse correlation of data from (f) and (g). Sirt6 signal was normalized by dividing by the β-actin loading control. Kla signal was normalized as in (h). The data were analyzed using a standard linear regression, R 2 = 0.84.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Over Expression, Control, Extraction, Lysis

(A) Western blot measuring histone Kla in WT and Sirt6-KO U2OS cells treated with sodium L-lactate and panobinostat, as indicated. A total protein stain (LI-COR) was used as a loading control. (B) As in panel A but measuring histone Kac. (C) Quantitation of selected data from panel A. Histone Kla signal was quantified using densitometry and corrected based on the total protein stain. Data are presented as a fold change from the untreated (-lactate, -panobinostat) condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. p 1 = 0.03, p 2 = 0.02, p 3 =0.005, p 4 =0.002. n=3, error plotted as s.d. (D) Quantitation of selected data from panel B. Data was processed as in panel C. n=3, error plotted as s.d. Quantitation of additional conditions is available in figure S4.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot measuring histone Kla in WT and Sirt6-KO U2OS cells treated with sodium L-lactate and panobinostat, as indicated. A total protein stain (LI-COR) was used as a loading control. (B) As in panel A but measuring histone Kac. (C) Quantitation of selected data from panel A. Histone Kla signal was quantified using densitometry and corrected based on the total protein stain. Data are presented as a fold change from the untreated (-lactate, -panobinostat) condition. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. p 1 = 0.03, p 2 = 0.02, p 3 =0.005, p 4 =0.002. n=3, error plotted as s.d. (D) Quantitation of selected data from panel B. Data was processed as in panel C. n=3, error plotted as s.d. Quantitation of additional conditions is available in figure S4.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Staining, Control, Quantitation Assay